blob: ae371948ea6bcd8f322ec17b16e86c6681ede3f2 [file] [log] [blame]
%PDF-1.7
%âãÏÓ
1 0 obj
<<
/Subtype /XML
/Length 3498
/Type /Metadata
>>
stream
<?xpacket begin="" id="W5M0MpCehiHzreSzNTczkc9d"?>
<x:xmpmeta xmlns:x="adobe:ns:meta/" x:xmptk="Adobe XMP Core 4.2.1-c043 52.372728, 2009/01/18-15:08:04 ">
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about=""
xmlns:xmp="http://ns.adobe.com/xap/1.0/">
<xmp:ModifyDate>2012-10-03T15:22:32+01:00</xmp:ModifyDate>
<xmp:CreateDate>2012-10-03T15:21:03+01:00</xmp:CreateDate>
<xmp:MetadataDate>2012-10-03T15:22:32+01:00</xmp:MetadataDate>
<xmp:CreatorTool>Acrobat Editor 9.0</xmp:CreatorTool>
</rdf:Description>
<rdf:Description rdf:about=""
xmlns:dc="http://purl.org/dc/elements/1.1/">
<dc:format>application/pdf</dc:format>
<dc:title>
<rdf:Alt>
<rdf:li xml:lang="x-default">Untitled</rdf:li>
</rdf:Alt>
</dc:title>
</rdf:Description>
<rdf:Description rdf:about=""
xmlns:xmpMM="http://ns.adobe.com/xap/1.0/mm/">
<xmpMM:DocumentID>uuid:fb5ac626-995f-4fd5-9eb0-12589fea1190</xmpMM:DocumentID>
<xmpMM:InstanceID>uuid:d6655c8d-0e6a-4dcd-bd92-a158fbe99c8e</xmpMM:InstanceID>
</rdf:Description>
<rdf:Description rdf:about=""
xmlns:pdf="http://ns.adobe.com/pdf/1.3/">
<pdf:Producer>Adobe Acrobat 9.5.1</pdf:Producer>
</rdf:Description>
</rdf:RDF>
</x:xmpmeta>
<?xpacket end="w"?>
endstream
endobj
2 0 obj
<<
/K 3 0 R
/Type /StructTreeRoot
>>
endobj
3 0 obj
<<
/P 2 0 R
/K 4 0 R
/S /Document
>>
endobj
4 0 obj
<<
/P 3 0 R
/S /Part
>>
endobj
5 0 obj
<<
/Kids [6 0 R]
/Type /Pages
/Count 1
>>
endobj
7 0 obj
<<
/PDFWP 8 0 R
>>
endobj
8 0 obj
<<
/LastModified 9 0 R
/Private 10 0 R
>>
endobj
9 0 obj (D:20121003142103Z)
endobj
10 0 obj
<<
/Flows 11 0 R
/Version [1 0]
/MasterPages 12 0 R
>>
endobj
11 0 obj
<<
/Names [13 0 R 14 0 R]
>>
endobj
12 0 obj
<<
>>
endobj
14 0 obj
<<
/F 15 0 R
/Name 13 0 R
/Type /Flow
>>
endobj
15 0 obj
<<
/F 14 0 R
/P 6 0 R
/O 16 0 R
/N 15 0 R
/V 15 0 R
/Type /ContentRegion
>>
endobj
17 0 obj
<<
/MarkInfo
<<
/Marked true
>>
/Lang (en-us)
/Pages 5 0 R
/StructTreeRoot 2 0 R
/PieceInfo 7 0 R
/Metadata 1 0 R
/Type /Catalog
>>
endobj
6 0 obj
<<
/Rotate 0
/pdftk_PageNum 1
/MediaBox [0.0 0.0 612.0 792.0]
/CropBox [0.0 0.0 612.0 792.0]
/Resources
<<
/XObject
<<
/Fm0 16 0 R
>>
>>
/Contents 18 0 R
/Parent 5 0 R
/LastModified (D:20121003152103+01'00')
/Type /Page
/PieceInfo 19 0 R
/Annots 20 0 R
>>
endobj
21 0 obj
<<
/Matrix [1.0 0.0 0.0 1.0 0.0 0.0]
/Subtype /Form
/Length 39
/Resources
<<
/ExtGState
<<
/GS0 22 0 R
>>
/XObject
<<
/Im0 23 0 R
>>
/ProcSet [/PDF /ImageC]
>>
/BBox [0.0 0.0 301.0 225.0]
>>
stream
q
/GS0 gs
301 0 0 225 0 0 cm
/Im0 Do
Q
endstream
endobj
23 0 obj
<<
/ColorSpace /DeviceRGB
/Subtype /Image
/Length 880308
/Width 627
/BitsPerComponent 8
/Height 468
>>
stream
caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXWdXWdXWd]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac36Z]acffkk$)hXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac F�B�B�B�B�B
OkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac F�B�B�B�B�B
Okk]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacd\]iLLiLLgQRfVXd\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac F�B�B�B�B�B
OkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacgQRp10v{ { { { { { { { yyvvs'$r,*p10o65lAAlAAjFGgQRfVXfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac F�B�B�B�B�B
OkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNZ))d f i i q
s s s { { { { { { { { { { { { { { { { { { { { yvvs'$o65o65m<;lAAlAAd\]iLLfVXfVXcaccaccaccaccaccaccaccacH�B�B�B�B�B
LkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]CDRRRRRRRRRRRUUZ\_ a d f l l q
s v x { { { { { { { { { { { { { { { { { { { { yvvu!r,*M
E
!. ,. ,& 0 3
E__GHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRRUUZ\_ a d i l l s
u s
u { { { { { { { { { { { { { { { { { { { { vu!vu!r,*r,*p10m<;lAAjFGiLLgQRfVXd\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZ\^`bd f h m o q
s
u w y { { { { { { { { { { { { { { { { { { { { yxvu!s'$r,*p10m<;lAAlAAiLLgQRfVXd\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZ\^`bd f h m o q
s
u w y { { { { { { { { { { { { { { { { { { { { yyvu!s'$r,*p10o65lAAlAAiLLgQRfVXfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\^`bf f h m o q
s
u w y { { { { { { { { { { { { { { { { { { { { s'$u!u!u!s'$r,*p10o65lAAlAAjFGgQRfVXfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\^`bf f h o o q
s
u w y { { { { { { { { { { { { { { { { { { { { { yvvu!r,*r,*o65lAAlAAjFGiLLfVXfVXd\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRSZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^^^`f f h m m q
s
w w y { { { { { { { { { { { { { { { { { { { { { yvvu!o65o65m<;lAAlAAfVXfVXfVXfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\``bf f h o o q
s
w w y { { { { { { { { { { { { { { { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\``bf f j o o q
s
{ { { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacdbccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccackikpno¨§¨ÂÁÂùúùù÷÷ù÷ùù÷÷ù÷ù¹¸¹Š‡‰}|}jhjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacfdf”“”ÓÓÓ÷÷÷ýûúÿÿÿöðòõñôðíïõîïöîî÷ðòÿýüýùûÿÿÿÿüüùô÷„„jhicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacecd¨¤¤ýýýÿÿÿÿÿÿýöýïççÖÓÒÉÆȲ­¬µ¨¥®¨¤­¦¥ÑÎÑƼ½ÖÈÆÞÖÔöîîÿÿÿÿÿÿÿÿÿ¤Ÿ¤gefcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZh { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaca`a—•”õóõÿÿÿðíï÷ñóòíñ½¶µµ­ª­¢¥­žœ¥š”¥š¥žœ¦žœ­¢œ­¢œ³¦œµ®­ÎÃÃÖÏÕãÜÛüö÷üûúÿÿÿš˜™caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZh { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccacbbaÏÎÏùüùþüþ÷ï÷Á¿º½¾½­¬­¥ œœ–”¤–”¥–”¥™š¥žœ¯£ µª¥µª¥µ°ª·²­µ¯­µ®­¹®­Î¾½ÎÃÆçÝÞÿÿÿÿÿÿÛØØigicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccacuuuçááìéèïêïìæåÉÁ¿½µ»­¢¥¥š”œ–””Œœ’Œœ—‘¥œ­¢¥½®­¾¶­Æ·¶Æ¾½Æ¾½Îº½Î½µÆºµÆ¶­Æ¶¯Î¾µÖÊÊþëîÿÿÿÿÿÿˆ„ˆcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { u!caccaccaccaccaccaccaccaccaccaccaccaccac|yzåÛ×ôïïìççåãÞÞÜÞ½¶µ­¦¥Ÿ–”œŽŒ”ŽŒ”ŠŒœŽŒœ“¥šœµ§¥½²­ÈÀ¹ÎÇÆÏÇÆÖÈÆÖËÆÖËÆÖǽÎýξµÆ·µÆ¶µÎýïççÿþÿÿÿÿ‹‡ˆcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { s'$caccaccaccaccaccaccaccaccaccaccaccacrrrÐÔÏçåçïëççççÖÑÓ½·µµª¥œžœ™’Œ”Š„ŒŠŒ’‰Œ”Š„”’”œ’”¥ž”µ­¥ÎÇÆÖËÎÞÏÍÞÏÆÞÓÖÞÓÎÖÓÎÖÏÎÖËÆÎÇÆƺµÆ¶­Ë¼ºïãÞþýþÿÿÿ†‚…caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { s'$caccaccaccaccaccaccaccaccaccaccacjjjÁÀÁÚÙ×ççççæçÚÚÖÆÄÀ­®­¥¢œ—””ŽŒ”†„ŒŠŒ”Š„œ‘‘œ–”œ™”­¦œÆº½ÖËÎÞÏÈÞÏÆÞÓÖçÓÕç×ÖçÖÎÞÓÎÞÏÎÖÏÎÎÇÆÆý½³®Æ¹µçßÞþýþýúýusucaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { s'$caccaccaccaccaccaccaccaccaccaceee¦§¦ÆÄÆÞÛÞççççäçÖÓÎÆÃƯ®¥¥¡£œ’”œŽŒ”Š‹ŒŠŠšŽŒœ“¥œœµ¨¥Æ¶µÖËÈÞÑÎÞÓÎÞÑÑâÓÖç×ÖéÙÚçÙÚç×Öç×ÖàÖÎÝÏÎÎÇÆÎý½µ´ÎýòëïÿÿÿîâækikcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { s'$caccaccaccaccaccaccaccaccaccac€°¯°É¿ÞÛÞïãçÞáÞÖÏν¾½­®¥¥ŸŸœ–”œŽŒ”ˆˆŒŠ„œŽŒœ’Œ¥žœ½®¬Æ¼¹ÞÏÎÞÓÎÞ×ÖçÛÖçØØîÚÝïåäïãçïßÞïÝÞçÛÞçÙÒÞÓÎÐÃƽ²µ½°±ÖËÉÿ÷÷ÿÿÿ¡ž¡caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { r,*caccaccaccaccaccaccaccaccaclil¯²­ª¦¨½Ã½ÞÛÞçåâÞÛÞÒËν¾½µ®¥­¥£œ–œœŽŒ”ŠŒŒ†Œ”ŠŒœ’© œ½²­ÆýÞÏÆÞ×ÖçÛÖçÞÜïãÞ÷çç÷ïï÷ïï÷ëç÷ççïãÞçÛÝÞ×ÎÖËÆͺ¼½²µÄ·³åÚÜÿÿÿöóñsrscaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { r,*caccaccaccaccaccaccaccaccac‹‰‰‘“‘¥£¥¿¿½ÞÛÞçãÞÞÛÞÖÏÎÆÃƽ½º­ª­¤žœœ’Œ”Š„Œ†Œ“ŠŒœ’Œ¨Ÿœ½²µÎýØÏÎçØØéàÞïçç÷ìéùðïÿôðÿôñÿñï÷íëôéçïãßéÙÓ×ÏÇÎý½²µ½¯­ÎÇÆ÷ó÷ÿÿÿº¶¹caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { r,*caccaccaccaccaccaccaccacjhj•’”}|}”’”µ¶µÖÙÖçãÞÞßÞÝÖÕÎËÎÊÇƵ²­­¦¥œš–œ‘Œ”ŽŒ“Œœ’”¥žœµ®­Æ¼¹ÕÇÆÞÖÔïßÖïãç÷ëïÿóïÿú÷ÿÿÿÿ÷÷ÿóïùïï÷ççìÛÖÞÏÎÎýƲµµ®­Æ½¼ßÛÞÿÿÿöñóspqcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]\cSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { r,*caccaccaccaccaccaccaccac}~}suskqk„†„«­«ÎÐÎçßÞçãççßÞÞÛÞÎÓÎƺµ»¶µ­ª¥¥žœœšœœ–”œ–”¥š”­¦¥½¶µÎǽÖÏÎçÛÖïãÞ÷ëçÿó÷ÿÿÿÿÿÿÿÿÿÿó÷ÿïï÷ççïßÖÞ×ÖÖÇÆƶµµ®­½¯­ÖËÎ÷÷÷üúü¦ž¢caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXWdGHeGHeLMeXWdXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]\d58gkMRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { r,*caccaccaccaccaccaccaccbc”–”pomdec{z{œš–½¾½Ö×ÖççççççïçëÞßÞâßÞÎÉ˽º½µ®­­¦¥ žœ¥žœ¥žœµ¦¥µ®­ÆºµÎÃÆâÓÒïãÞ÷ëçÿ÷ïÿÿÿÿÿÿÿÿÿÿûÿÿó÷÷ëççãÞáØÖÖÍÊξµ¼²µ½²­ÖËÎïëïÿû÷ÈÅÇjhicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacWV_03gjkkkkkkkk$)h]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRgsssMRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { p10caccaccaccaccaccaccachicvvpZYZRURcec€„€­ª­ÎÏÎçãçïóïÿùû÷ó÷÷ïïïççÞÛÞÖÏÎÉÄÀ½ºµµ®­­¦¥µª¥µª­½´±Å¼ºÝËÎÞ×Öïççÿó÷ÿþýÿÿÿÿÿÿÿ÷÷ÿïç÷çÞçàØÞ×ÖÖËÆƺ½½²±½²­Æ¸½çáã÷óïéßãusucaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacH�B�B�E J J Q VkkkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacACl{{{{MRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { p10caccaccaccaccaccaccackqk^]^JMJBIBXUXknk”“”µ¶µÞÛÞ÷ó÷ÿÿÿÿÿÿÿÿÿÿþÿ÷÷÷ïïïçáâÖÓÎÆÃƽ¶µ¹°­µ®µ½²­½µ´ÆýÖËÆç×Î÷çç÷ïïÿ÷÷ÿó÷÷ïïïæåïäÞçßÖÞÖÔÖËÆƾ½½²­½²­½º½ÖÐÐèÝßìâ玍Œcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac$L�B�B�B�B�B�B�BkkkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacLMi{{{{{MRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { p10caccaccaccaccaccaca`asrkWZWJIJBEBJMJZ]Zsusœ–œÃýïëïÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ÷÷ïççÞ×ÖÎËÎƺµ½¶µ¼±­ÆºµÎýÖËÆçÛÖïÛÞïçç÷ççïããïãÞçßÞçÛÖÞÏÎÓÊÆƾ½½²­½µ²¿¹½ÑÒÑçßÞÖÖ֝™caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac$L�B�B�B�B�B�B�BhkkkRRdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacv|~{{{IRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { o65caccaccaccaccaccacfgfsusb]ZJIJBEBJEJJMJcaZ„‚„±®­ÞÛÞÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿýü÷ëçÞ×ÖÖÈÆÈ¿¼½¹»ÆµµÆº½ÎÆÄÜÎÆÞÓÖá×ÑçÛÖçÛÞÞ×ÖáÔÎÛÎÎÎÇÆƺµ½¶µµ²µ½º½¾·¶ÄÁ½ÎÏά¦£gegcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac%)N�B�B�B�B�B�B�BhkkkLMecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac;>q„„„„„„D&RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { o65caccaccaccaccaccacfhfsxsgggRURBIBFCFJIJRURkmk”’ŒÆ¾½ïççÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿùûçãçÝÒÎÆÃÆƺ½Æ¶µ½º½Æýǿ½ÎÃÆÎýÎýÎýÒÅÆÎÇÆÎýƺµµ²µµ²µ½¶µ¹±±·¶µÆÃƱª©jhjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac%)N�B�B�B�B�B�B�BhkkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXWdRRdXWdXWd]\cXVbXVacaccaccaccaccaccaccac{{{{{~|D&RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { o65caccaccaccaccaccackigsus{uscacQNQEIEJIJJQJcac{y{¥  ÎÇÎû÷÷ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ÷÷çâæÞÓÎÎÇƽ¹º½¶µµ®­µ²µµ²µµ®­»­­½²µÆ¶µÎ¾½ÎÁ½½¶µµ®­µª¥µ®­³®«µ®µ¶³°ª¥¦xuxcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac+/P�B�B�B�B�B�B�BfkkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac;>fkssssrphf$iiXWdcac;>m{{{{{{{IRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZs
{ { { o65caccaccaccaccaccachjhsup„‚{sqkcacZYRZQRRURc]Zlml†Š„¥ ¢ÆÃÆÞâÞÿúþÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ÷ïïçãçÝÒÏÎÆÆƼ¿µ²µ­¦¥­¢œ¥žœ­žœ© œ­žœµª¥½²­½¶µÆº¶½µ³µª¥­¦¥¬©¥®¥©­¦­¥žœœœœ|y|caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac+/P�B�B�B�B�B�B�BckkkACfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac58ksst{xz{pkkkkkLMe$u{{{{{{t@'RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { o65caccaccaccaccaccacljgsskŒŠ„„†„{yskmkceccdccecsqs{|{ŒŠ„¥žœ­®­Æ¾½ÏÐÎÖÓÎÜÓÎÖÓÖÎÏÎÎËÆÆÇƽ»½»¶µµ°°°¨­Ÿ¡Ÿœ———“”—Œ”ŽœŽœ’Œ¥š”¦¢œµª¥½°±½²­µ®­µ¦¥œœœšœ¢œ¢œš””–””•”usucaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac14R�B�B�B�B�B�B�BckkkACfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac03p{{{{{{{skkkkkkisssssssn;,RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { m<;caccaccaccaccaccacgigsqk‹†{ŒŠ„‚|ƒ}{sys{yssys{ys„‚„„Š„”’ŒŸžœ¥ª¥µ®¥µ²­­²­µ®¥­ª­¥¦¥¥žœœšœ”–”›’””ŠŒŒŠŒ„†„Œ†„Œ†„Œ†„Œ†„”ŠŒœŽŒ¤™”­¢œµ®¥½²­µ¦¥¥šœœ–””’””’‘”’ŒŒŠŒ”Ž”omocaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacWV_ F�B�B�B�B�B�Bak$iGHecaccaccaccaccaccaccaccaccaccaccac]\b]\bcaccaccaccaccacGHj{{{ƒ‚tkkkkkkkkqsssssslD!RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRIU @';,28$ITZZZ`?3VaRS`HI`CD^89]./]./\$%[[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { m<;caccaccaccaccaccacgegknk„‚{„†{„†{„…ƒ„{}{„‚|„‚{Š‡‚ŒŒŒŒŽŒ”–”œš”œžœ¥¢¥¥žœ¥¢œ¥¢¥œšœœ–”œ’Œ”ŽŒŒŠŒ„Š„„‚{„‚„{}{{y{„}{„‚{„‚„ˆ„œ’”¥žœ­ª¥µ®­­¢¥œš””ŽŒŒ‡„Ž‡†Ž‹Œ„ƒ‹††kijcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac][aPP]JK[>@W]\ccaccaccaccaccaccaccaccaccaccaccacRRfijggc#g$(h#g$(ent{{„„„„kkkkkkkkkkkkkkkkk;,RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRI$*XLMfssssssmkk03gcaccaccaccaccaccaccaccaccaccaccacb\^aRSaMN`CD`CD^89]./])*\$%[[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { m<;caccaccaccaccaccacdcdklf{}s„‚{{}s„}{{ys{ysƒ}{{‚{ƒz„‚}„ƒ„‡†„Œˆ‰ŒŠŒ”ŽŒ”‘”ŒŽŒŒŽŒ”Š„ŒŠŒ„†„Œ†„„}{{}{{y{sus{us{us{us{ww„~}Œ†„œ’Œ¥ž”µ©ªµ¬ª­ŸŸœ’ŒŒ†„„}{„€~„†„uys„‚€caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac03pwwvuttsplkkkkw„„„wkkkkkkkkkkkkkkkkk62RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRI  @kk03lu{{{{{mkk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^aRSaMN`CD]./[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { m<;caccaccaccaccaccacdbddfcsqksuksuk{ussqssuksussussts{uk{ussys{ys{}{{‚{„}{„}„{}{{}{„ys{xz{u{tqs{qssmksmksmssms{usysŒ‚{”ŽŒ¥š”­¦œµ®¥µ¦¥¥ž””ŽŒˆ{{us{„}{susrnrcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac03p{{{{{{{skkkkkkpw{{kkkk P Wkkkkk k k h d k kk62RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRI
 Akko{{{{{wkkk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`CD]./[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { lAAcaccaccaccaccaccaccaccdckmckmkkmcpkhkikkmccickikkikkickickikkmksmksqssqssqksqssqskqksmksqskmkkikkikjicsiksqs{us{y{Œ†„œ’”¥žœ­ª¥µª­²¤¥œ–”Œ†„{y{sqszxv{y{spqsrscaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXWdACfACfACfAChzz}||{{ukkkkkkkko{vkkk <������5kkkk d c c c cgk;,RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRD  
�-kko{{{{{tkkk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`CD^34ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { lAAcaccaccaccaccaccaccacca_dickicdicceckeccacc^cZaZ_a_cacZaZceccacceckikkekcgckeckikkekceckeckeckdiceckekkmk{qk„ysŒ{–ŽŒ¥›•­¦¥µ®­µª­­¢¥œ•“Œ‚}{usqmkmfkkik}|wnlncaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacPP]"_fkkkkkkks„„kkkkkkkkko{pkk @���������� Pkkk e c c c chk28RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR;    1����!kkkx{{{{kkkk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^34ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { lAAcaccaccaccaccaccaccaciiiceZceccaZZaZcacZ]ZZaZZ]ZZYZZ]ZZYZZ]ZZ]ZZ]Z^]Zc^]Z]ZZ_Z_]Zc``c]cZ]Zf`Z`aZkackhhxtp{y{‰€{Œ„ š”­¢œµª¥½®­µª¥­¢œœ–ŒŒ‚{wsskikceceecyqvcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXWd;>fACfACfLMeXWd]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacD�B�B�B�E J J Vkkkw{pkkkkkkkkkkrkk L�����(kkk58gcac]\cRQcLLcRRdRRdN)5RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRA    X C���� �kkkoxw{qk ^fk58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaRS\ ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { jFGcaccaccaccaccaccaccaccacglgZ`ZZ]Z]]ZZ]ZZYZZUZRURRSRRURZYZRURRURZUZRVRRURZURZUZRURRYRZYRZ]ZZ]Zcackic{mk„ysŒ†„”ŽŒœ–”­¢œ­ª¥µ®­µ¯­­ª¥¥žœœ’”„‚„sqskec]^ZcdaheecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRd03gjkkkkkkkk$)h$)hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]\cXWdcaccaccaccaccac F�B�B�B�B�B�B
Lkkkwxkkkkkkkkkkkkkk�!�)�)�)�%�(�-kkk58gcaccaccaccaccacXWeC8RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRA    Xk!������ Lkkkpkpkk Yfk58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^89ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { jFGcaccaccaccaccaccaccaccachhh\_[Z]RRYRQQQMNMOPOQPQJMJJMJBIBJMJJIJJQJRQRJMJJQJOQJRURRURZYRc]ZcaZkik{yz„~{ŒŠ„”Ž„¤–“­ž”µ¦œµ®­µ®­µ²­µª­­¡¤œ“„}swpk`a]c]cdaacaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd"ikkkkkkkkkkkkk]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacGHe$ikkkkji$)h Q T�B�B�B�B�B
Lkkkwtkkkk P5 Jkkkkkk"^�0�2�2�1�1�1�1kkk$)hcaccaccaccac;>js-ARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRA  " Skk������������(kkkkkkkk�Bfk58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac])*ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { jFGcaccaccaccaccaccaccaccaccac[ZWSYRRURJMJJIJBIBBEBBEBBEBBBBBEBJB?BGBCIBJLHJMJJPJRURZYRcaZdeckmk„ysŒ‚{”ŽŒœ–”œš”¥¡œ©£œ­¨¥³ª¥¸®¥½®¥²ª¥­¢œŽŽ…sqscbcigi]ZZfdfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac;<f k k k k k k k kkkkkkk$)hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacPP]
O Q V \ \afkkkka�B�B�B�B�B Gkkkwkkk J!��������� Wkkkkk)-_�9�9�9�9�9�9�9hkk$icaccac]\d$oss-ARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRC " & Lkk J������������ kkkkkkk Y�Bf$)hRRdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaMNZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { jFGcaccaccaccaccaccaccaccaccacfdfQTQOQJJMJBIBBEB9A99<9BABB<B9A9BC@BEBBEBBIBRMJZURZ]Zcecpictnl„}{Œ†„”’Œ¥–”¥š”©¢œ­¢¥­¦¥­¦¥­ª¥µª­­ª¥­¨¥œ–”Œ†„kaZc]aZZWa\Zcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac01g k k k k k k k kkkkkkkjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacWV_�B�B�B�B�B�B�B Vkkka�B�B�B�B�B Gkkkkkkk'���� �� ��'kkkkkQQa�9�9�9�:�9�9�9ckk$icac]\dxtuu-ARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRK ! ) 1 tkk <���������������/kkkkkkGHe][a]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { iLLcaccaccaccaccaccaccaccaccaccac```RQJJLJBEBBAB9899<99;99<99A99A99A9JIJJMJRURZ]Zsiksqs{}s…‚{”Š„œ–”¥š”¥Ÿœ¥žœ¥¢œ­¢œ­¢œ²¢œµ§¦µ¦¥­¦œ­¢œœ“Ž{ysZ`ZRUNSXScbccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaci k k k k k k k kkkkkkkkRRdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacWV_�B�B�B�B�B�B�B Tkkka�B�B�B�B�B�Ekkkkkk H������kkkkicac�B�B�B�B�B�B�Bakk$iRRg{{{{{-ERRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR ) 1 6  Bnkk46Z101���������������^kkkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { gQRcaccaccaccaccaccaccaccaccaccaccacV[VJMJBEBBEB9891811819899<9BABBCBJIBNQNc]Zkecsqk„}sŒ†„”‹Š–•Œžš”¥š”¥š”¥žœ¥žœ¥ œ¥£œ­¦¥­¦¥­§¥¥¤œœ—”…‚|Z\XZVSWTRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k kkkkkkkkk*.hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac][a�B�B�B�B�B�B�B
Okkka�B�B�B�B�B�Ekkkkkk�!�'�'�&�%�$�$_kkk03gcac�B�B�B�B�B�B�B ^kk$i$u{{{{{(LRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR= ) 1 5 9 {kkkcaccac101878 ��� JkiGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaRSZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { gQRcaccaccaccaccaccaccaccaccaccaccaca`aTUQPQL9A99<91811419899<9BABJKBRMJRSRcaZsmk{ys„†|ŒŽ„—’œš”œš”œš”œž”œš”¥Ÿ•­ž”­¢œ­¢œ­¥¢¥¢œ¥š–Œ‚{jkfRURJOJWYWcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkkkkkicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac58g#i$(fah#e$'cAAcAAcRQbRRdXWdcaccaccac][a�B�B�B�B�B�B�B
Okkka�B�B�B�B�B�Ekkkkk)-`�)�)�1�1�1�1�1 Ukkk*.hcac�B�B�B�B�B�B�Bakks„„„ƒ(QRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR) 1 4 B )9kkk58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`CDZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { gQRcaccaccaccaccaccaccaccaccaccaccaccacaaaRURBEB9<91811411419<9BABJIJRQJZYRcaZlmk~zuŒ†„”ŽŒ”–Œœ–”œ–Œœš”œ–”¥š”¥šš¥žœ¥žœ¥žœœž”œ–”Œ„„ljdPPPJLI^Y\fddcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkkkkkk]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXWepsssssssrmkkkkACfcaccac�B�B�B�B�B�B�B
Okkka�B�B�B�B�B�BkkkkkXWd�1�1�1�1�8�9�9 Xkkk58gcac�B�B�B�B�B�B�B \kks„„„„„„(QRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRD 1 9 B J lkkkLMecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`CDZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccac_^_JQJ9?99<91811411819<1BA9MJEVSN^[Vkecspk{}sŒ†‚š‘‹œ’Œ”’Œ”•Œœ•’œ™”£š¥˜˜ ˜œ–”“‰Œƒ‚caZNMJEGELKLdddcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkkkkkk;>fcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacGHhsss{wy{{pkkkkkkk03gcac�B�B�B�B�B�B�B
Lkkka�B�B�B�B�B�Bkkkkkcac<�9�9�9�9�9�9 Lkkk58gcacD�B�B�B�B�B�B \kko{{{}|x(CRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR9 ; B J -3kkk$icaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]./ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccacdcdPTP9@97871411411819<9BE9BIBRQRZUR[YZkec{vsŒŠ„ŒŽ„”Ž„›‘‹œ’Œœ’Œ”’Œ”ŽŒŒŠ„„~{uumWVUBEBBDB\\\dbdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac*,h k k k k k k k kkkkkkkkkkicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac58o{{{{{{{{rkkkkkkkkkACf�B�B�B�B�B�B�B
Lkkka�B�B�B�B�B�Bkkkk;>fcac E�?�>�<�<�B�B Lkkk58gcacD�B�B�B�B�B�B \kko{{{{{s(CRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRJ B B J R kkkkLMecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]./ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaceceWYWBEB9<97;71411819<9BE9JIBQPQYTQb\Ykic{ys„‚{Œƒ}Œ†„Œ†„’†„ˆ„|ytkmc```XWR9@9FFFa`acaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkk3kkkkk]\ccaccaccaccaccaccaccaccaccaccacXWd;>f*.h03gACf*.lxxx{{~„nkkkkkkkkkkj�B�B�B�B�B�B�B Jkkka�B�B�B�B�B�Bkkkk03gcac F�B�B�B�B�B�B
Okkk;>fcacD�B�B�B�B�B�B Ykko{yx{{oORRRRRRRRRRRRRRRRRRRRRRRRRRRRRRH I J T D !kkk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\ ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacefeIPI?D?1811411819<9<A9BEBJMJRUJZ]RceZsmksmksmksmkmjeZ\ZROJBEB7<7A@ARORfefcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k kkkkkk�&kkkkkACfcaccaccaccaccaccaccaccacWV_"_kkkkkkkkkk~„„ykkkkkkkkkkkk�E�B�B�B�B�B�B Jkkka�B�B�B�B�B�Bhkkk58gcacH�B�B�B�B�B�B
Okkk;>fcacD�B�B�B�B�B�B YkkmssssqkORRRRRRRRRRRRRRRRRRRRRRRRRRRRRNH N R Z ; -kk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaRSZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^^^FLF9@97;76:64:4;<49>9BB9BFBJMGLNFJJDJJDKMJJIFJFB:=8?B?LNLa`acaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkk X�!]kkkk$)hcaccaccaccaccaccaccaccac�B�B�B�B G J Q Qhkkk„„kkkkkkkkkkkkka�B�B�B�B�B�B Gkkkk�B�B�B�B�B�BhkkkGHecacH�B�B�B�B�B�B
Okkk;>fcac F�B�B�B�B�B�B YkkkkllomkORRRRRRRRRRRRRRRRRRRRRRRRRRRRRM R R Z Z 19k;>fcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\ ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacdbcZZZLQLEHE@B?1511411411512521418;8181;B;QQQ`a`cbccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkk X�! KkkkkjcaccaccaccaccaccaccaccacD�B�B�B�B�B�B�Bhkkk~„wkkkkkkkkkkkkka�B�B�B�B�B�B Gkkkk�B�B�B�B�B�BhkkkRRdcacJ�B�B�B�B�B�B
Lkkk;>fcac F�B�B�B�B�B�B Vkkk h k k kkkORRRRRRRRRRRRRRRRRRRRRRRRRRRRRR R Z Z c X<HXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`HIZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacdbd`^`^]^VUVSWSTWTSWS][]\\\cacnmncaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkk
F�!3kkkkkLMecaccaccaccaccaccaccacD�B�B�B�B�B�B�Bfkkk~„kkkkk < <kkkkkk
L�B�B�B�B�B�Ekkkk�B�B�B�B�B�BfkkkGHecac$L�B�B�B�B�B�B
Lkkk58gcacH�B�B�B�B�B�B Vkkk c c c chkTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR Z Z c c cVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac!i k k k k k k k kkkkk K�!�&kkkkk*.hcaccaccaccaccaccaccac F�B�B�B�B�B�B�Bckkkwtkkk W������������(kkkkk
L�B�B�B�B�B�Ekkkk�B�B�B�B�B�BckkkLMecac$L�B�B�B�B�B�B
Lkkk58gcacH�B�B�B�B�B�B Tkkk Z Z Y ZikTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZ Z c c c caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`CDZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkk K�!�! VkkkkjcaccaccaccaccaccaccacH�B�B�B�B�B�B�Bakkkwkkkk���� ��
�������� Rkkkk
L�B�B�B�B�B�Bkkkk
L�B�B�B�B�Bckkk]\ccac%)N�B�B�B�B�B�B Jkkk58gcacJ�B�B�B�B�B�B Tkkk R R R RkkTRRRRRRRRRRRRRRRRRRRRRRRRRRRRU Z c c k jcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k kkkkkk2��7kkkkkXWdcaccaccaccaccaccacJ�B�B�B�B�B�B�B ^kkkkkkkGHe�������-kkkk Y�B�B�B�B�B�Bkkkk
L�B�B�B�B�Bakkk]\ccac%)N�B�B�B�B�B�B Jkkk58gcac$L�B�B�B�B�B�B Tkkk�B�B�B�BkkZRRRRRRRRRRRRRRRRRRRRRRRRRRRRU c c k k icaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_>?ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkk-��(kkkkk;>fcaccaccaccaccaccac$L�B�B�B�B�B�B�B \kkkkkk*.hcac
%�!�!�!�"�!�!�&kkkk Y�B�B�B�B�B�Bkkkk
L�B�B�B�B�B ^kkkRRdcac+/P�B�B�B�B�B�B Gkkk58gcac$L�B�B�B�B�B�B Qkkk
E�9�:�;kkZRRRRRRRRRRRRRRRRRRRRRRRRRRRR\ c k k k h,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkk����fkkkkicaccaccaccaccaccac%)N�B�B�B�B�B�B�B \kkkkkkcaccac%'@�1�.�0�1�1�1�1`kkk Y�B�B�B�B�B�Bkkkk
L�B�B�B�B�B ^kkkLMecac+/P�B�B�B�B�B�B Gkkk58gcac%)N�B�B�B�B�B�B Qkkk
@�1�2�1 Zk eRRRRRRRRRRRRRRRRRRRRRRRRRRRR_
k k k s iAAcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^89ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkk V���� Lkkkkk]\ccaccaccaccaccac%)N�B�B�B�B�B�B�B \kkkkk$)hcaccac+/G�1�1�7�6�6�5�4^kkka�B�B�B�B�B�Bhkkk
L�B�B�B�B�B \kkkGHecac14R�B�B�B�B�B�B Gkkk03gcac%)N�B�B�B�B�B�B Qkkk;�)�)�! Tk`RRRRRRRRRRRRRRRRRRRRRRRRRRRRb k l s s j<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaRSZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac!i k k k k k k k kkkkk V����2kkkkkACfcaccaccaccaccac+/P�B�B�B�B�B�B�B Ykkkkk58gcaccac8:Q�9�9�9�9�9�9�9 Xkkka�B�B�B�B�B�Bhkkk
L�B�B�B�B�B \kkk]\ccac14R�B�B�B�B�B�B�EkkkACfcac%)N�B�B�B�B�B�B
Okkk3�!�� Lk`RRRRRRRRRRRRRRRRRRRRRRRRRRRRk k s s s k65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ`{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkk G����"kkkkk$)hcaccaccaccaccac+/P�B�B�B�B�B�B�B VkkkkkLMecaccac8:Q�9�9�:�9�9�9�9 \kkka�B�B�B�B�B�Bhkkk
L�B�B�B�B�B Ykkk]\ccac8:U�B�B�B�B�B�B�Ekkk$)hcac+/P�B�B�B�B�B�B
Okkk*���� 8k`RRRRRRRRRRRRRRRRRRRRRRRRRRRRk k s s s k65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ`{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]\c k k k k k k k kkkkkk G�����akkkkjcaccaccaccaccac14R�B�B�B�B�B�B�B TkkkkkcaccaccacDEY�B�B�B�B�B�B�B Tkkka�B�B�B�B�B�Bfkkk
L�B�B�B�B�B YkkkXWdcac8:U�B�B�B�B�B�B�Bkkk$)hcac+/P�B�B�B�B�B�B
Okkk!������k eRRRRRRRRRRRRRRRRRRRRRRRRRRRRk k s s s k65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\$%ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ`{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkk-����� GkkkkkGHecaccaccaccac8:U�B�B�B�B�B�B�B Tkkkk$)hcaccaccacDEY�B�B�B�B�B�B�B Tkkka�B�B�B�B�B�Bckkk
L�B�B�B�B�B VkkkRRdcac8:U�B�B�B�B�B�B�Bkkk$)hcac14R�B�B�B�B�B�B
Lkkk������������ P eRRRRRRRRRRRRRRRRRRRRRRRRRRRRk s s s s k65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]./ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ`{ { { ycaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkk-�����(kkkkk*.hcaccaccaccac8:U�B�B�B�B�B�B�B Qkkkk*.hcaccaccacJK[�B�B�B�B�B�B�B Vkkka�B�B�B�B�B�Bckkk
L�B�B�B�B�B Vkkk;>fcac>@W�B�B�B�B�B�B�Bkkk$icac14R�B�B�B�B�B�B
Lkkk������������ eRRRRRRRRRRRRRRRRRRRRRRRRRRRRk s s s s m,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_>?ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ`{ { { ycaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac01g k k k k k k k kkkkkk�������kkkkkjcaccaccaccac>@W�B�B�B�B�B�B�B Qkkkk*.hcaccaccacJK[�B�B�B�B�B�B�B Tkkka�B�B�B�B�B�Bakkk
L�B�B�B�B�B Tkkk;>fcac>@W�B�B�B�B�B�B�Bkkk$)hcac14R�B�B�B�B�B�B
Lkkk ,������������(RRRRRRRRRRRRRRRRRRRRRRRRRRRRk s s s s m,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`HIZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZb{ { { ycaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac!i k k k k k k k kkkkk V������� QkkkkkXWdcaccaccacDEY�B�B�B�B�B�B�B
Okkkk03gcaccaccacPP]�B�B�B�B�B�B�B
Okkka�B�B�B�B�B�B ^kkk Y�B�B�B�B�B Tkkk58gcacDEY�B�B�B�B�B�B�Bkkk$)hcac8:U�B�B�B�B�B�B Jkkk]\ccaccac][]POPPOP>=>RRRRRRRRRRRRRRRRRRRRRRRRRRRRk s s s s m,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaRSZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZb{ { { ycaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkk K�������7kkkkk58gcaccaccacDEY�B�B�B�B�B�B�B
Okkkk58gcaccaccacWV_�B�B�B�B�B�B�B
Okkka�B�B�B�B�B�B \kkk Y�B�B�B�B�B Tkkk58gcacDEY�B�B�B�B�B�B�Bckk$)hcac8:U�B�B�B�B�B�B JkkkXWdcaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRk s s s s m,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZb{ { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXVd k k k k k k k kkkkkk#(^��������kkkkkicaccaccacJK[�B�B�B�B�B�B�B
Lkkkk58gcaccaccacWV_�B�B�B�B�B�B�B
Okkkk�B�B�B�B�B�B \kkk Y�B�B�B�B�B Qkkk58gcacDEY�B�B�B�B�B�B�Bckk$icac8:U�B�B�B�B�B�B GkkkLMecaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRk s s s s m,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZb{ { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkkLMe !�������akkkkk]\ccaccacJK[�B�B�B�B�B�B�B
Lkkkk58gcaccaccac][a�B�B�B�B�B�B�B
Lkkkk�B�B�B�B�B�B \kkk Y�B�B�B�B�B Qkkk;>fcacJK[�B�B�B�B�B�B�Bckk$)hcac>@W�B�B�B�B�B�B GkkkACfcaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRs s s s s n'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac])*ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZd { { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac;<f k k k k k k k kkkkkkXWd+-9������� GkkkkkACfcaccacPP]�B�B�B�B�B�B�B JkkkkGHecaccaccac][a�B�B�B�B�B�B�B
Lkkkk�B�B�B�B�B�B Ykkk Y�B�B�B�B�B
Okkk58gcacJK[�B�B�B�B�B�B�Bakk$)hcacJK[J FD�B�B�B Gk$)hRRdcaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRRq s s s s n'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZd { { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac01g k k k k k k k kkkkkkcacPPU�������-kkkkk$)hcaccacWV_�B�B�B�B�B�B�B Gkkkk;>fcaccaccaccac�B�B�B�B�B�B�B Jkkkk
L�B�B�B�B�B Ykkk Y�B�B�B�B�B
Okkk03gcacPP]�B�B�B�B�B�B�Bakk$)hcaccaccaccaccaccac][aPP]DEYXWdcaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRq s s s s n'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZd { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaci k k k k k k k kkkkkicaccac��������kkkkkkcaccacWV_�B�B�B�B�B�B�B Gkkkk58gcaccaccaccac�B�B�B�B�B�B�B Gkkkk
L�B�B�B�B�B Vkkk Y�B�B�B�B�B
Lkkk$)hcacPP]�B�B�B�B�B�B�Bakk$icaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRq s s s s n'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZd { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkk*.hcaccac!/������� QkkkkkGHecac][a�B�B�B�B�B�B�B�Ekkkk58gcaccaccaccac�B�B�B�B�B�B�B Gkkkk
L�B�B�B�B�B Tkkk \�B�B�B�B�B
Lkkk$)hcacWV_�B�B�B�B�B�B�BakkjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRq s s s s n'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkk58gcaccac>>G�������7kkkkk*.hcac][a�B�B�B�B�B�B�B�Ekkkk58gcaccaccaccacD�B�B�B�B�B�B�Ekkkk
L�B�B�B�B�B Tkkk ^�B�B�B�B�B
Lkkk$)hcacWV_�B�B�B�B�B�B�BakkkcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRq s s s s n'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkkLMecaccac][^�������"kkkkkjcaccac�B�B�B�B�B�B�B�Bkkkk58gcaccaccaccacD�B�B�B�B�B�B�Ekkkk
L�B�B�B�B�B Tkkk \�B�B�B�B�B Jkkk$)hcacWV_�B�B�B�B�B�B�B ^kj58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacTRRRRRRRRRRRRRRRRRRRRRRRRRRRo s s s s o!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkkXWdcaccaccac !������� VkkkkkRRdcac�B�B�B�B�B�B�B�Bkkkk03gcaccaccaccacD�B�B�B�B�B�B�Ekkkk
L�B�B�B�B�B Qkkka�B�B�B�B�B Gkkk$)hcaccacPP]JK[>@W14R%)NJ F]ACfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacTRRRRRRRRRRRRRRRRRRRRRRRRRRRo s s s s o!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac*,h k k k k k k k kkkkkkcaccaccacGHe[ L
A7-"�� Lkkkkk58gcac�B�B�B�B�B�B�B�Bkkkk$)hcaccaccaccac F�B�B�B�B�B�B�Bkkkk
L�B�B�B�B�B
Okkka�B�B�B�B�B Gkkk$icaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacTRRRRRRRRRRRRRRRRRRRRRRRRRRRo s s s s o!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZf { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkkiRRd*.hkkkkkkkkkk[kkkkkicacD�B�B�B�B�B�B�Bhkkk$)hcaccaccaccacH�B�B�B�B�B�B�Bkkkk
L�B�B�B�B�B
Okkka�B�B�B�B�B GkkkicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacU RRRRRRRRRRRRRRRRRRRRRRRRRRRo s s s s o!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZh { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkkkkkkkkkkkkkkkkkkkkkk]\cD�B�B�B�B�B�B�Bhkkk$icaccaccaccacJ�B�B�B�B�B�B�Bkkkk G�B�B�B�B�B
Okkka�B�B�B�B�B�EkkkicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacU RRRRRRRRRRRRRRRRRRRRRRRRRRRm s s s s o!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZh { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkkkkkkkkkkkkkkkkkkkkkkACf F�B�B�B�B�B�B�Bfkkk$icaccaccaccac$L�B�B�B�B�B�B�Bfkkk
L�B�B�B�B�B
Lkkka�B�B�B�B�B�EkkkjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacU RRRRRRRRRRRRRRRRRRRRRRRRRRRm s s s s pcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZh { { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkkkkkkkkkkkkkkkkkkkkkk$iH�B�B�B�B�B�B�Bckkk$icaccaccaccac%)N�B�B�B�B�B�B�Bfkkk
L�B�B�B�B�B
Lkkka�B�B�B�B�B�Bkk$)hRRdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacW)*RRRRRRRRRRRRRRRRRRRRRRRRRRRm s s s s pcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkkkkkkkkkkkkkkkkkkkkkkkJ�B�B�B�B�B�B�Bckkk$)hcaccaccaccac%)N�B�B�B�B�B�B�Bckkk Y�B�B�B�B�B JkkkjPP]PP]>@W14R%)N$L58gXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacW)*RRRRRRRRRRRRRRRRRRRRRRRRRRRm s s s s pcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac!i k k k k k k k kkkkkkkkkkkkkkkkkkkkkkkkkkk
L�B�B�B�B�B�B�B ^kkk$)hcaccaccaccac%)N�B�B�B�B�B�B�Bckkk Y�B�B�B�B�B JkkkjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacW)*RRRRRRRRRRRRRRRRRRRRRRRRRRRm s s s s pcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkkkkkkkkkkkkkkkkkkkkkkkka�B�B�B�B�B�B�B ^kkk$icaccaccaccac+/P�B�B�B�B�B�B�Bakkk Y�B�B�B�B�B GkkkjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRi
s s s s pcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac[ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k kkkkkkkkkkkkkkkkkkkk[2(kkkkka�B�B�B�B�B�B�B \kkkicaccaccaccac14R�B�B�B�B�B�B�Bakkk Y�B�B�B�B�B Gkkk$)hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRi
s s s s qcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZj { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkkkkkkkkkkkkk[2����kkkkkk
L�B�B�B�B�B�B \kkkjcaccaccaccac14R�B�B�B�B�B�B�B ^kkk#(a%)N$L FD�B�Ej58gXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRi
s s s s qcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkkkkkkkkkkk[2������ Qkkkkka�B�B�B�B�B�B Ykkkkcaccaccaccac8:U�B�B�B�B�B�B�B ^kkk58gcaccaccaccaccac][acaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRi
s s s s qcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkkkkkkkkjACfcacDDL�������7kkkkka�B�B�B�B�B�B Vkkkkcaccaccaccac8:U�B�B�B�B�B�B�B \kkk03gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacY34RRRRRRRRRRRRRRRRRRRRRRRRRRRg s s s s qcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac!i k k k k k k k kkkkkkkkkk$)hRRdcaccaccac][^�������"kkkkkk
L�B�B�B�B�B Vkkkkcaccaccaccac>@W�B�B�B�B�B�B�B \kkk$)hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacY34RRRRRRRRRRRRRRRRRRRRRRRRRRRg s s s s qcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkkkkj;>fXWdcaccaccaccaccaccac!/�������fkkkkk
L�B�B�B�B�B Tkkkk]\ccaccaccacPP]�B�B�B�B�B�B�B Vkj58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacY34RRRRRRRRRRRRRRRRRRRRRRRRRRRg s s s s rcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZm { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]\c k k k k k k k kkkkkkkRRdcaccaccaccaccaccaccaccaccac>>G������� Gkkkkka�B�B�B�B�B Tkkkk]\ccaccaccaccaccac][aPP]>@W8:U%)N$L!ZLMecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZ89RRRRRRRRRRRRRRRRRRRRRRRRRRRg s s s s rcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkk*.hcaccaccaccaccaccaccaccaccaccacWUZ�������-kkkkkk�B�B�B�B�B Qkkkk]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZ89RRRRRRRRRRRRRRRRRRRRRRRRRRRg s s s s rcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkk;>fcaccaccaccaccaccaccaccaccaccaccac !�������kkkkkk
L�B�B�B�B
OkkkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZ89RRRRRRRRRRRRRRRRRRRRRRRRRRRg s s s s rcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac01g k k k k k k k kkkkkkLMecaccaccaccaccaccaccaccaccaccaccac+-9������� Qkkkkka�B�B�B�B
OkkkkRRdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\>?RRRRRRRRRRRRRRRRRRRRRRRRRRRe s s s s rcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZo { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac!i k k k k k k k kkkkkkcaccaccaccaccaccaccaccaccaccaccaccacPPU�������7kkkkka�B�B�B�B
LkkkkLMecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\>?RRRRRRRRRRRRRRRRRRRRRRRRRRRe s s s s rcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkkjcaccaccaccaccaccaccaccaccaccaccaccaccac
�������kkkkkk
L�B�B�B
LkkkkGHecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\>?RRRRRRRRRRRRRRRRRRRRRRRRRRRe s s s s s caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXVd k k k k k k k kkkkkkicaccaccaccaccaccaccaccaccaccaccaccaccac%'4�������akkkkka�B�B�B Gkkj58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]CDRRRRRRRRRRRRRRRRRRRRRRRRRRRe s s s s s caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkk*.hcaccaccaccaccaccaccaccaccaccaccaccaccacDDL������� Gkkkkka$L F�B GjACfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]CDRRRRRRRRRRRRRRRRRRRRRRRRRRRb s s s s s caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZq
{ { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkk58gcaccaccaccaccaccaccaccaccaccaccaccaccac][^�������(kkkkkk]\ccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]CDRRRRRRRRRRRRRRRRRRRRRRRRRRRb s s s s s caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac01g k k k k k k k kkkkkkLMecaccaccaccaccaccaccaccaccaccaccaccaccaccac&�������fkkkkkRRdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRRb s s s s s caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { lAAcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccac88B������� Qkkj58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRRb s s s { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { lAAcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkkkcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacPPU>>G88B%'4!/ !�7iLMecaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac^HIRRRRRRRRRRRRRRRRRRRRRRRRRRR` s y { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZu { { { lAAcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkkicaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRR` s { { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { lAAcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkk*.hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRR` s { { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { jFGcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkk58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRR` s { { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { jFGcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac*,h k k k k k k k kkkkkkACfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac_MNRRRRRRRRRRRRRRRRRRRRRRRRRRR` s { { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { jFGcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacj k k k k k k k kkkkkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRRRRRRRRRRRRRRRRRRRRR` { { { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZw { { { jFGcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkkkcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRRRRRRRRRRRRRRRRRRRRR^ { { { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkkkk$icaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRR^ { { { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacAAf k k k k k k k kkkkkk58gcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRR^ { { { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac56g k k k k k k k kkkkkk;>fcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRRa { { { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZy { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac$'h k k k k k k k kkkkkk;>fcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRRRRRRRRRRRRRRRRRRRRRRRRRR_ { { { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaci k k k k k k k kkkkkkXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRR_ { { { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac k k k k k k k k kkkkk$)hcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRR_ { { { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRQd k k k k k k k kkkj58gXWdcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^RRRRRRRRRRRRRRRRRRRRRRRRRRR_ { { { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacXVdLLeAAf*,h*,hj kjACfcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRR_ { { { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { fVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRR\{ { { { { gQRcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacbWYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRR\{ { { { { jFGcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRR\{ { { { { { { { u!u!lAAlAAlAAfVXfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWYRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { d\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRRZ{ { { { { { { { { { { { { { { { yvr,*o65lAAiLLfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacRRRRRRRRRRRRRRRRRRRRRRRRRRR\{ { { { { { { { { { { { { { { { { { { { { { { { yvr,*p10lAAjFGfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRZZZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa i l s v { { { { { { { { { { { { { { { { { { { { { { { { { { vs'$r,*lAAlAAfVXd\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRZZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa f l q
v { { { { { { { { { { { { { { { { { { { { { { { { { { yvr,*o65lAAiLLfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRZZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa d l q
v { { { { { { { { { { { { { { { { { { { { { { { { { { yvr,*p10lAAjFGfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRZZZZZZZZZZZZZZZZZZZZZZZZ\{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacSRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa d l n
v { { { { { { { { { { { { { { { { { { { { { { { { { { { vs'$r,*lAAlAAfVXd\]caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRZZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZ\a l l v x { { { { { { { { { { { { { { { { { { { { { { { { { { yvr,*o65lAAgQRfVXcaccaccaccaccaccaccaccaccaccaccaccaccaccac`RSRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa i l s v { { { { { { { { { { { { { { { { { { { { { { { { { { yvr,*p10lAAiLLfVXcaccaccaccaccaccac`RSRRRRRRRRZZZZZZZZZZZZZZZZZZZZZZ^{ { { { caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa f l q
v { { { { { { { { { { { { { { { { { { { { { { { { { { { vs'$r,*lAAj76RRRRRRRRRZZZZZZZZZZZZZZZZZZZZZ^{ { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacU RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa d l q
v { { { { { { { { { { { { { { { { { { { { { { { q
RRRRRRRRRRZZZZZZZZZZZZZZZZZZZZ`{ { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacU RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa d l n
v { { { { { { { { { { { { { { { q
RRRRRRRRRRRZZZZZZZZZZZZZZZZZZZ`{ { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacV$%RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZ\a l i s v { { { { { { q
RRRRRRRRRRRRZZZZZZZZZZZZZZZZZZ`{ { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacW)*RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRUZa i l l RRRRRRRRRRRRRZZZZZZZZZZZZZZZZZ`{ { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacW)*RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZZZ`{ { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacW)*RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRWZZZZZZZZZZZZZZZb{ { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZZb{ { { xcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZZb{ { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZZb{ { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacX./RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZZd { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacY34RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZZd { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacY34RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZd { { { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZ89RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZZZZd { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZ89RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRWZZZZZZZZf { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacZ89RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRSZZZZZZZf { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\>?RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZZf { { { u!caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\>?RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZZf { { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\>?RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZZf { { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac\<;RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZZf { { { s'$caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac]AAZ89X./U TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZf { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWY_MN]CDX./W)*TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZZh { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^`RS]CDY34X./TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZZh { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RS]CDZ89X./V$%TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRZj { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWY_MN]CDX./W)*TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRj { { { r,*caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^`RS]CDY34X./TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRf { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RS]CD\>?X./V$%TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRf { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacaWY_MN]CDX./W)*TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRf { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^`RS]CDY34X./TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRi { { { p10caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RS]CD\>?X./V$%TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRi { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^_MN]CDX./W)*TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRi { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^`RS]CDY34X./TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRi { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RS]CD\>?X./V$%TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRl { { { o65caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^_MN]CDX./W)*TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRl { { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^`RS]CDY34X./TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRl { { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RS]CD\>?X./V$%TRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRl { { { m<;caccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^_MN]CDX./W)*TRRRRRRRRRRRRRRRRRRRRRRRn
{ { vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^aWY]CDY34X./TRRRRRRRRRRRRRRRRn
{ vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac`RS]CD\>?X./V$%TRRRRRRRRn
vcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccacb\^`RS]CDX./W)*TRjcaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccaccac
endstream
endobj
18 0 obj
<<
/Length 12
>>
stream
q
/Fm0 Do
Q
endstream
endobj
16 0 obj
<<
/BBox [108.0 72.0 504.0 720.0]
/Resources
<<
>>
/Matrix [1.0 0.0 0.0 1.0 0.0 0.0]
/FormType 1
/Subtype /Form
/LastModified 24 0 R
/Length 0
/PieceInfo 25 0 R
/Type /XObject
>>
stream
endstream
endobj
26 0 obj
<<
/Subtype /U3D
/Length 71128
/VA 27 0 R
/Type /3D
>>
stream
U3D� ���J���������x���Ø�����j������������������ �CreatedBy5�3dif.x3d 24 (Deep Exploration 5.7 5.7.3.4977 Release)��ÿÿÿ�����������ÿÿÿ������� �DefaultView��������������$ÿÿÿ†������� �DefaultView�����a²&?B!B?öwû<����˜QZ¾/i>Zbw?����w:?Ã"¿Å‚>����iCóÝkÃyœÂB��€? �DefCamera������€?ÿÿ_��ðA��€?��€?������������������CÿÿÿD������� �DefaultView��� �����€?����DefCamera##animation1����������€?���?ÿÿÿì��������text�������������"ÿÿÿV��������text�����ìQB����������������ìQ6ëQB��������ëQÂìQ6����Aþ‚Âræ!Bù-AÁ��€?�text�����Eÿÿÿ"��������text������������
�Blue Satin��Cÿÿÿ8��������text��� �����€?����text##animation1����������€?���?ÿÿÿä��������arch�������������"ÿÿÿV��������arch�����ÿÿ3þÿ?���€����þÿ¿ÿÿ3���€������������þÿ?����1^ÂÊfB•5©Á��€?�arch�����Eÿÿÿ��������arch�������������Red�Cÿÿÿ8��������arch��� �����€?����arch##animation1����������€?���?ÿÿÿô��������sphere�����������"ÿÿÿZ��������sphere�������€?������������������€?������������������€?����R„B³ÀÁWk|¿��€?�sphere�����Eÿÿÿ#��������sphere������������ �Aluminium�Cÿÿÿ<��������sphere��� �����€?����sphere##animation1����������€?���?ÿÿÿŒ������� �AmbientLight�������������#ÿÿÿb������� �AmbientLight�������€?������������������€?������������������€?������������������€? �AmbientLight��ÿÿÿ”��������text������������1ÿÿÿr��������text��������$����¿���������������������������������ô��è��X��…\?:��€8÷_:Jõ-<“ȇ<fff?���?ö(|?������ÿÿÿ”��������arch������������1ÿÿÿr��������arch��������ˆ���D��������������`�������������������D���D���ô��è��X��åI<��€8÷_:Jõ-<“ȇ<fff?���?ö(|?������ÿÿÿ”��������sphere����������1ÿÿÿt��������sphere��������ø��~��~����������¹������������������~��~��ô��è��X��Lc;��€8÷_:Jõ-<“ȇ<fff?���?ö(|?����ÿÿÿD������� �t02268990�����������Uÿÿÿ ������� �t02268990 �� �������êT��Vÿÿÿ#��������DefCamera##animation1����¯ D;ƒqB;�Vÿÿÿ��������text##animation1����¯ D;ƒqB;��Vÿÿÿ��������arch##animation1����¯ D;ƒqB;��Vÿÿÿß��������sphere##animation1���¯ D;��€7�sphere���¢Ü;���8������������������€?���€���€���€���������������������«ª���ÄV��`{Ò�h&Hpüö�@ö…ˆ�0Ê¿G-�¥�
>�@ÿõJ�°P«� †„��"Í/@.Q��Y¹®(Œ!�€$Â`&��æ ���,���,���,�����������������Sÿÿÿ4�������
�Blue Satin����������������������
�Blue SatinSÿÿÿ&��������Red�����������������������Red��SÿÿÿÉ������� �Aluminium��������������������� �Aluminium �t02268990¤p½?���?��€?������������������€?������������������€?������������������€?��€?������������������€?������������������€?������������������€?���TÿÿÿH�������
�Blue Satin?���������������±°°=…„>áà`?������������������������������€?TÿÿÿA��������Red?���ñðð=ñðð=ñðð=ßÞ^?��������Î3š>Î3š>Î3š>������������ÍÌL>��€?���TÿÿÿG������� �Aluminium?���õôô>õôô>õôô>ÓÒÒ>ÅÄÄ>ÅÄÄ>|ì©>|ì©>|ì©>������������ÌÌÌ>��€?�Qÿÿÿ7������� �AmbientLight����ÍÌL>ÍÌL>ÍÌL>��€?��€?����������4C��€?�Rÿÿÿ1������� �DefCamera����������������������������������zD���ÿÿÿ����������\ÿÿÿùT������ �t02268990����ÿØÿà�JFIF������ÿÛ�C� 
  $.' ",#(7),01444'9=82<.342ÿÛ�C  2!!22222222222222222222222222222222222222222222222222ÿÀ�  "�ÿÄ�����������
ÿÄ�µ���}�!1AQa"q2‘¡#B±ÁRÑð$3br‚
%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ��������
ÿÄ�µ��w�!1AQaq"2B‘¡±Á #3RðbrÑ
$4á%ñ&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚâãäåæçèéêòóôõö÷øùúÿÚ� ��?�ãqF)h¨,(¢Š�)E%( –’”P�)h¢€ŠJ\К3EXŠ3I@RPIE!4�LÐM!4�HM!4ÒhÄÓI¤-L-@-M-HZšZ€ZšZ˜ZšZ€$-M-L-L-@–¦–¨ËÓKÐ+’—¦–¨‹Ò .J^šZ¢/H^€”½4µD^½RôÒõ jBô)zizˆµ4½�J^˜Z£/M-@—¦—¨‹Ò  R¨‹Òn  7Rf£ÝHZ‹.ê7T;èÍ0&ÝFê‡4f€&ÝFjô¡©X sKº¡ J‹6ê\Ô;¨Í}ÔàÕêPÔ8jpj€=(j�²œ«‡§  éáê°zxz,ÔðÕX=<=!–CSÃU`õ j�°ž«†©Pá©ÁªÔðÔ04 ÔA©Á¨PiA¨Á§@¢›šZ�vh¤¥�QE�QE‹EP ¥¤´ (¢”P ¢Š(� RÑ@ÑKŠLP0¢Š(�¥”
-Q@ @ Q@ E% Í¤Í ¤Í„ÐÒHM!4�HMÓI &šM!4ÒÔ�¥©¥© S P‹SKSKS P‹SKS Ó ÐËÓKTeé…èBÔÒõjajv!jBõzaz�˜½4½B^½�L^š^ /H^€'/M/P—¤/E€˜½0µD^½RôÒÕzBôÂä¥é¥ª"ô…è ’¤/Q¤ÍrBԙ¨ËR D»©7TY£u�IºÕê7P›¨ÝQî£u�Iº—uEºÔ.ê]ÕiCP¹¥ÝPî¥Ý@îMº”5B—urpôàõ�jPÔ`=8=WNJÀXOUƒÓƒPÕ zªž€-©U@Õ z@Z Rª¡ª@ôË!ª@ÕU^¥V e€ÔðÕ�jxj�˜5<„5<�”Pi€Òƒ@¥¦ƒK@RRŠ�(P(h¢@
(¢Š�)hP@ RÐEPTQE�!¢–Š�J(¢€ŠJ3@ Fhͤ͠͠Í&i3Iš�Ri3A4„ГM&šij�Ri¥© SKP�ZšZµ0µ�8µ0µ4µFZ€Z£/M-Q— —¦¨ËS P!婅©…é…é€òÔÒõzaz�½4µDZš^˜—¦—¨‹ÓKP&/M/Q¦– DÅé ÔE黨]ô…ê,Ѻ€$ÝIº£-M-@n¤Í0µ!j�yjBÔÍԅ¨ù µ0µ!4X.<µ©™¤Í ÝFêfhÍ ÝFêfhÍ ÝKº£Í¢ÀH”5Gš3@\5©›¨ @n¥ Q¥Ý@朡 J€& N P§  ÃӃT©CPôðõX5<5¹d=<5VOJÀZR+UEz=�[W©CU@õ(j,¥j‘Zª«TÊԆY O UÃTŠÔ84ðjÔðh@iÀÓ§@¥¦Šu�-@ ¥”´�RŠJZ�(¢@�¥¢Š�(RŠÑE�QE�†Š( Š( ŠLњ�3Fh¤&€šBi3HM�ÒHM!j� SKR¦ -L-HZ£-@-Q–¦—¨Ùèåê2ÔÒõz<½FZ˜Z˜^˜/L/Q–¦ –¦¦¦¦Zš^£-M-@‡—¦—¨ËSKP…饩…© P÷R¨óAjãËQº£ÝA4X.<µ&êfhÍ Ž-Fêa4f‹vêBi3HM0šBi¹£4�ìњm&hÙ£4Üњ�\њLњ�\њLњ�\Ò曚3@ͦæŒÐÁ£4ÌÒæ€ .i™£4 4¡ª0iA †¥ QƒJ !ܔ5(j‹u(j�˜5<5@œ€,§†ªÁ©á¨Èz=U R+P2Øz•Zª+ԪԀ´¯S+UEz•^ÕªPÕUZ¥V e•j5W R«PÀÓÁ¨CSÁ  E(¦O€)E4S¨E-%-�(¢E�
)h�¢Š(� QE�EE¤Í�-!¢Š�(¢Š�(¢’€
J)  4™ šBh�&šMÓ  -M-HZ˜Z€µ0µ4µ1š€jc=5š£/@…g¨ËSKÔeé€âÕ=1ž£-@/L/L/L-L¦¦–¦ C‹SKS S PËS SKR ¦æšM!4Âã·RIšBh¤ÑšnhÍ�;4™¤¢€4™£4Pš3E! ¤Í-%�£4Q@Q@Q@i3KŠJ�(¢Š�(¢Š�3KšJ(sFi( £4”¹ 4fŒÑš�PiA¦Ñš�x4L”�x4àÕ4 Ð¡©Áª iCR8j5W O @UªUjª­R«P¥j•^ª«TªÔ†[F©•ª¢5J@ªEjªS+ReZ¤««T¨piàÔ@ÓÁ  8S§
�p§
h¥ 
)-�´”
�Z(¢€
(¢€!¢Š(QE(¢’€
J)  �šBh&šM�ÒA4Âh�&˜Z‚ÔÂÔ�¦3R3TLÔ�¬ÕjFjˆµž£/Mg¨Ù逥ê6zizš‹�¬õjBÕjbZ˜ZšZ˜Z€Z˜Zµ4µ�)jBÔÒi ¢ÂšLÒIL&“4Rf€“4Q@hÍPE£�RÑF(�¢ŒQŠ�)1KŠ\PqF)Ø£�ÜQŠv)1@ Š1KŠ1@ E.)1@(Å£�bŒQŠ1@(Å£�˜¥¢Š�J)hÅ�%¸¤ –’Š�\ÑIFhÔMÍ-�8Pi™§@O PƒO•€˜5H  O @Ë*Õ*µU R«P¤j™ª+TÈԆ[F©‘ª¢5L@•ªejªS+ReZ¤««TªÔ04ðjiàТ”S§Š�u(¦ÒÐÑE�fŒÑEfŒÑE*(¤4 Q@%†€
Bh4„ÐHMÓ  �šaj ¦ �µFZ‚Õ5� Õ5 Õ=j…ž†j‰š˜=FÍHÍQ3SYª2ԌÕj8µ0µ4µ0µ�8µ0µ!4Òh°\q4Òi ¤&˜…&š)3@£4Q@Q@
Z�AF)qKŠ�LQŠv(€—J�&(Å.)q@ ŧbŒPqF)Ø£�ÜQŠv(Å�7b—b€˜§b“�˜£¸£�ÜQŠv(Å�7bŠ1@ ŧb“�ÜQŠv)1@ Š)qE�&))qE�%¸¤Å�QE�( RRŠ�PiÀÓh€%ž¡ž �L¤V¨SÕ© ²­S#UUj‘Z€.#TÈÕM¦F¤2â5LTѪtj@[V©Uªª5J­@Ë*Õ 5µH­@O¢ž �H -0p4�êQM¥ ¢“4´�QE!¥¤40
”�SM-! 4Òh&šM�Ó ¥&£&€šc5ª6j�k5FÍJÍP³P�ÏP³PÍQ3S3TLÔ3TLÔÀ TLÔ3Te¨¦ µ0š� SI šBiˆ ¤&šC@ E%�QE�QKE�QK@ ŠZP(€ QŠ\S±@ ”
P)@ €)Ø¥€.)Ø£�ÜR❊1@ Å&)ø£�ÌQŠv(Å�3bŸŠ1@ ŧbŒPqIŠv(Å�7˜§â“�ÜQŠv(Å�7˜§âŒP1AìPE�4ŠJv)1@ Åâ)1@ Ÿ¢€ÒS©1@ EPÐ))h”`§@O PƒO€&V©CUpÕ"µ!–Uªdjª­R«P´j©£TÈԆ\F©‘ª¢5LH jÕ"µVF©•¨`5H @­R@J F <�x¥¦ƒN ¢’–€ŠJQ@RZC@¦šq¦š�CM4ãL4�L&‚i„ÐQ±§1¨™¨ªjs5Dí@ f¨]©ÎÕ µ1ÍP³R³T,ÔÀª&jVj‰šjaj ¦@4Âh&šbi(¤ ¤¢Š�(¢Š�(´PJ PŠ1J(�˜§b€)q@ ŠP)Ø 
�� 
p P@¥Å( PF)Ø¥Å�0
1OÅ bŒSñF(˜£ò("€E&)ø¤Å�4ŠLSñHE�3bŸŠ1@ ŧâ“�ÜRbŸŠLPqIŠ~) ‘HE<Š HE<ŠB(˜¤Å<Š1@ "’ŠLPi ?Ó@ E-�Ú)h @¢€ (4ÚPh@i᪠iÀÒ`XV©ª¸j•Z–Qªdj¨­S#P4[F©‘ª¢5LH ˆÕ25TF©Ñ¨c,«TÊÕUZ¦V¤àÓÁ¨Uª@hPiÀÔ`Ӂ  (¦ŠQ@¢’–€#¤4¦Ð1 4Ӎ4Ð! 0Қa4�„ÔliÄÔlh¬j&js‰Ícª'jWj…Ú€Ú¡v¥v¨Y©€ŒÕjVjš˜†³TdғQ“@4ÂiI¦“L@M%”�QE�QE-�QK@ Šv(”
�LS€ 
P(�”
P)@ — S€ — R@ Š\RJ�&(œ(�Ð)qJ(�€QŠv(Å�7bŠ1@ ŧâ“�ÌQŠ~)1@ "ŒSÈ£�Â)©¤Å�3bŠ1@ ŧF(„QŠy„PqHE<ŠB(„RO"Š�a„SȤ"€E!ò)¸ Aâ) ÒS©())i �
%�-- ¢€ 8`§@R+T ÓÁ¤2uj™Z«+TŠÔi§FªhÕ25.#TÈÕM§F¤´j™Zª£TÈԆZV©ªêÕ(j�œx55 4 4áQƒN€)i Pi -! ši¥4Ó@j2iÄÔlh¬j64æ5�cµBíOv¨\ÓBíP¹§»TÔ�×j…šœíQ1¦ k5DƜƣ& &˜M)4Òiˆ ¦ÑE�%Q@QŠ�- PKKF(�Š�¥€
pJ��S€ 
P(�”
P)@ �
P)@¥€
\RJ�  RJ� N”
�n(Å8
1@ ŧâŒP1F)ø£�ÌRbŸŠ b‚)ø Š�ŒŠ§âŠ�a„T˜¤"€E§â‚(2)©¤Å�3˜§‘HE�0ŠB)äR@ "ŠyÒ(˜¤"žE4Š�aqÒ(¦’œi �4ŠJu4ÐQKI@ KE%�:H)hÀӁ¨Å8�˜zµB <C,+TÈÕYZ¤V  hÕ:5SF©‘©1—ªdj¨S£RÒ5L­UQªejCT€Õuj•M&ž B <�p¦J �ÓJi¦€Ó 8Ó  “Q±§Q± 1¨XÓØÔ,híP»SÜÔÔ�Çj…ÚžíP»S@1š¢cNcQ1¦!¬j2iÄÓ  “HiM6˜„4Ph Š)h� QŠp �P(œ��R@ P�;J��S±F)@ œ�R@)ÀP:€
\P)€�)@¢Š�@)@£à( S€¥ŒPKŠP)@ âŒSñF(˜£üQŠ�f(Å?b€Š§âŒPx¤"¤ÛFÚ�„T…i IŠŠB(2)©1IŠ�aÒ*B)¤P¤"¤Å4Š�ŒŠ§‘M"€E!ò)¤PdRO"šh†ÓȦš�aq¦š�i¤4êJ�J(4P�(¢Š�8SihàӁ¨Á§@+T¡ª¸5*µ!–ªejª­R£PÄj™ª+TÈԆ[F©Õª¢5NCʵL«#TÊԆN <…MH �J 8Œp4�¦šiM4ÐM0šq54�Ö5{‰Í�Fæ¡v§¹¨]¨ÇjÍHíP;S65s‰0cÔDÓØÔDÐ! ¦SHiˆCM4¦Š�JZLRÐJ�R@� P(�KŠ�§@� QŠp�˜§@ P�(¸¥ –ŠZ�)Eá@�¥‚œ(EN�Jœ�  RJ�  RJ� NŒPbŒS€¥Å�3bŸŠ1@ Åiø£Ú6ԛi
Ð{i
ԄR@ "ŠŠiO"“„SȤ"€#"Šy„PdRO"šE�0Ši!Â(„RO"šE�0ŠCN"Š�a¤4â) J}4Ði :’€Š �P(¢€œ 0S…�<„x4˜«TªÕ]MJ­@Ë(Õ25UV©Ð2Ò5NUQªdj@[F©‘ªª™Ë!ª@jj”�˜p54ðhæ˜iƚh„ÓӉ¨˜ÐXÔ,jF5 šÈÜÔjG5š�cµ@æ¤sP9¦€c…=DƘ†L&œM0ÐM%)¦šb
(¢€
Z)h�”
8
��¥€)ÀP��RN€
P(œ�&)ÀP(�RÐ-�´RÐJ(ê�( RŠ�QJ(¢€N€)@ à(”
��¥”
P(� 
p P@¥ŠP)\âŒS±Kj�f(Å?b€V“&ÚLPdRRHE„SH©¤"‹Ò*R)¤S2)¤T„SH L"¤"šE�0Šiò)¤P¦‘O"šh„RyÒ(„SH§‘HE�0Šiò) IN"Š�a¤§‘M4�ÚCN¤4�”RÒPKI@ 
p4ÁN 5*š„zšC,)©Qªºš•M�ZF©Ñª¢šËHÕ25VF©‘¨`YCS)ªèjU4†N <ˆ�Ó 8Ó �0š=DƀÆ sR9¨\ÐNj5+š®æ˜†9¨XÓÜÔ,iƒÆ¡cOcQ“@†“L4ãM4! IA¢˜- ¥ ¥‚œ(@¥€)ÀP�( R@�¸¥”
�� 
\S±@.(”
�LRâ”
P(�Ŕ
P(�¥€)@ �
pJ��S€ 
P(�œ�R@�à(œ 
pN€
P)@¥€
\S±@Â@à)q@Xn(ÛOŒP1IŠ“˜ ,FE!&)1@XŒŠi)Ò(Ò*B) ˆ¦‘RM"‹Ò*B)¤S2)¤SȦ‘@‘HiæšE�0Šiò) M"žE!�Â)¤SȤ"€E4Šy„P¤"žE4Š�a Óˆ¤ )ƚh1@¥¤Å�-(¤¥�áO£ñI2š•MWSS) e„52®†¦C@Ñe L†«!©ÐÒÊ™MWCS)¤MH B¦¥ZLj6§ŒÐ ¨˜ÔŒj'4šÍJæ sM‰Í@æ¥sP9 œÔ,jG5b#&£&žM0Ð %)¦šbE
�ZZJQ@
)N� R@§@�ð)�§@� RJ�  RJ�  RJ�4
p P� 
p PJ�S€ œ�S€ œ�S€ œ�S€¤�(OØ@)@¥œ�  RN€
P)@¥€8
P)@ â—m;»h<PEI¶­�GŠB*LR@HEHE4Š�ˆŠB*B)„PdSH©¦‘@ˆˆ¦‘RM"€""ŠyÂ)€Â)¤T„SH M"žE!�Â)¤SȤ"€E7üR@ "ŠyÒ(„RO"šE�0ŠB)äSH  8Ši âŠv)1@ J(Å�¢ž)‚œ(AR)¨…H) ™ L† Z™ E„5:®†¦J@YCS!ªéS¥ DëRŠ…jA@ɍ0ÓÍDÔ…ÍJÆ¡s@9¨Ô®j4…ÍBæ¤sP9¦€cš…=ÍDƘ†a§a †ÒšJb
QIK@
)E §
�QOÑO� SÀ¦Šx� S€ 
p�J�S€ ”
P)@ ”
p@.)ÀR@ Å.)@§@ ”
v)@ ”
p@� RJ �)@¥”
�RJ8
�@)ÀRJ� à)@§@ œ(à´®@¥œ¶€¶—m?m¤6Òm©1FÚ�ˆ­!Z­!Z`DE4Š”­4­")„TÄS¦$S©ˆ¦@‘M"¥"˜E#"˜EHE4Š`FE4ŠŠi�Â)¤SȤ"€E7üR@ "ŠyÒ(„RRM"€#"ŠŠi„T„S HE<Ši�ÚJq„PqJ(Å �S‡jJp 
Tb¤†‰¦J…jU  S¥VJ) °•:T S% –¦
Ô«HdÆ¢j{Tm@9¨\Ô¬j4 ‘9ªîjg5š`Dæ cR9¨\ÓFÆ¢4ö5 CM0Ӎ4Є4ÑA¢˜�§
AJ(E8R
p 
p¦Šx 
p¤ð(@§@à(�œ�S€ �
�§J�&)@¥œ�4
p S‚Ð�§m¥Å8-�4-.ÚpZP´�hÅ?m(Z@4-(ZvÚP´ @´ S‚Ò… ”
pZP(�§Jœ€-8-(ZpZ@4-8-8-8-¡iÁiÁiBÒ†b”-?m;m�DV­M¶­�DV˜V¦+HV€!+L+S•¦§q•¦S¦ ¦SQ‘Lˆ¦R‘L"€dDSH©¦@ˆÈ¤"žE4Š`0Ši!Ò(„RO"šE�0Š§‘MÅ�3„SñHE�0Šiò) Ȥ"žE4Š�ŒŠB*B)¤PdQŠyÒ(˜¥Å.(Å�%(£ P…<S<RcD‹R¯j‰{T«Ú€&Z @µ2Òc,%N•]*tíCu©V¡Z•i •ª©¢s@9¨\Ô®j»šȜÔjg5]Í0"sP¹©Ô.iƒ#jŒÓÍFhÓM¥4†˜„¢Š�-( RŠ�p§
h§Š�QO‚ž(E<
@)àPN€)àP�8
�§@�à(œ� à)@§ …§¥ N @ N Jœ€ŠpZvÚpZ@3¡iا cv҅§¥Û@ ÛJ¶”
�@´¡iÀR@�ZP´à´à´€hZxZÓÂÐÀ@´¡iÁiÁi @´¡iÁiÁh¡h OÅ8- #ÛIŠ—mi ZiZ˜­4­�@VšV§+L+@ÊÓ
Ôåj6ZhDj2*rµ
L"¦"˜E0!"˜EJE4ŠDE4ŠŠiÀŒŠB)äSH Aò) M"žE M"¤Å4Š�aÒ*R)¤PdSH©H¦@‘M"¥"šV€#"šEJVšE�0ŠLT„Rb€ŠP)Ø£�N€SÀ¤Àp©˜*E d«S-Bµ2Òc'Jj©’†ËR­Dµ*Òö¨\Ô­P¹ œÔjW5šhD.j5+šÍœÔ,jG5 S1©†œi†1¦ÒšJb´RŠ�8R
p ñH<
�P)àRO€

hð(ÀSÀ¤ž��SÀ 
p�N”-<-�4-8-8-(Z�@´¡iáiBÐB҅§…¥ H…¥ O @Za»ivӀ¥€(ìP�  S€¥€
P)@§@� P)�ð)<R�ž §
��§@§
C
P)@§@ Å&Ú~("€#+M+RHE�DV£"¦"˜E0 "£aS0¦0¦„@¢aS°¨ØP€„ŠŒŠ™…FE0!"˜EJE0ŠFE4ŠŠiÀŒŠB)äR@ "“ò) AüQ¶€#"›Š”­&Ú�Œ­4­JV­�DVšV¥+HV€"+L+S¤+@•¦•©ŠÒ ¶Òm©1I¶€#ŧí£m�  Râ”
L¤Ð)ë@ɦZ‰jT˜É–¦J…jd¡2Ô«Ú¢Z•i V¨^¥z…è5š™ÍWzhD.j©^ z�‰ê#R5DiˆŒÓ <Ó �Ä4”´b˜„§RRŠ�QNSÀ ž ð(@©�¦R@
<
�§@
<-iáh� O Jž€ž”-<-°iBӂÓÂÐӂӂӂҁiÛiÁivÐvÐ?b€ŠP)qF(�¥ŒQŠ�-PŠQIJ �8RŠh4ài�ñNÀiA¤‚ž*0iÀЂœ*0ÔàÔ ¥¦J A¦ƒA4ài ÒL.4Ó <ša C¢aRšŒÓ@D£"¥5¡
a1ÀˆŠa)Ò( Ò*R)¤P€˜©
Òm¦eh+Rm£m�EŠ
Ô»i6Ð{hÛRí¤Û@m¦â§+HV€!ÛM+S”¤Û@¦•«)¥(¹ZiZ°RšR€ +M+S•¦• vѶ¤Åh=´ S¶Ò@<
@)ÀRñR­F¢¥ZLd©R­Fµ*ЫR­D½ªUíHb=Bõ+š…訧z®ôн@õ3Ô-B w¨š¥j‰»ÓÃL4óL4�”PhÄœ))€SÀ¤ž�("Šh"Š�rŠ‘E "Š�põZE"Š�Pµ ZjEZW� O @Z-1ˆž”-8- -(ZxZpZ�hZP´à´à´�À´»iûhÅ�3bœE!�ÓHE>˜h�¤4Bh ‹š3L&‚ÔÇæ€i›¨Ý@§¨CRî  ƒSƒT!©CÒÀjPÕ�zpz@Nž«§‡  ÃS·Upôàô6hÍC¾—w½�JZµDZ‚Ô�òÔÒi¥©¥©Ø&˜iKSI 5§ši¦f˜EHi¤PDSH©H¦• DEi¥j\PV˜•£.Ú6ÐX£.Ú]´(ÅL€´Ú6ÔÁ)vP=©6U”›(”Ò•d¥!J�¬RšR¬”¦• 
Å)¥*ÉJaJ�¬VšV¬¦ 
ÓJÔåi¥h-´m§â´�À)àP8
C
S�©¢E©–¢Z•i*Ԃ£Z”R1ûÔS¿zè Õw«Uށ¿SP5Lõ ÷¦-Q•»Ôf˜23M4óM4m´P„œ)8SEH4SÅ�<
‘E0Tª(ÀTª)Š*U˜QRLQS( (©STTª(
-4

�P´ð´O @œœ”-�4-8-8
\P1HE<ŠB(„Rq¦š�a¦šq¦@„&šMÓ P�Zµ4µ0µ�HZ“}D^µ�M¾—uAº€ô`=(j­¾—}�ZJªï¥ß@Ã҇ª¡éCÒ°î[K¾ª§¢ÁrÖúPõP=8= –·Ñ¾«o£}�XßAj€=(z,»© ¦n 50šCIšZ�i¤"ŸŒÑŠEŠ
ԛhÛB"´›jm´lö¦;hÛS¥ @ì¥ÛSm¥ @l§l©‚Rì BQ²§ÙNÙ@¶Q²¬ì£e�V)HR¬”¦” 
Å)…*ÙJiJ�¨R£+VÊÓ
ÐB´Âµe’˜V€+¦«%j2´ZBµ)ZiZ�f)@§b€) �§¨ 
p "ÓJ)"ԋQŠ”RFýê©ÜT/@È zê L¬õ Š°õŠ`BÕ©Z¢j`ÈÍ4ÓÍ4Ð!´¢Š(ž)¢œ)ˆx§Š`§Š�‘jU¨ÅH(E©V£Z•i"Ô«Q­J´"Š‘EFµ0 hzŠxÑR-�8

h§@
8
�§@ —¸ Š�i†žE0Ð 0ÓÍ0Ðf£&žÕbÆ£f¥cQ3P�Z˜Z‘š¢-@/H^¢/M/@ï£}@Zô>ú7Õmô»éX ;éCÕmôo  AéÁê z]ôh=8=TK¾€-ï¥U҇  éCÕPôàôh=8=VR+Pá©àÔ
Õ 4(§i¢ž��S¶Ò…§… £(JP´À‹m*}”¡( ”¡*`”à”�JpJ˜%8%�@œ¦ O @ÂRì«)vP}”l«;()@vSJU¢”…(¡JaJ¶R˜R€)•¦2U¶Zˆ­�Td¨ÊU¦JŒ¥�Te¨ÊՖZ–€+•¦©ÊÓ
Ðx£ò(Å!œ�SÀ hU©E0S֐-Jµ© DoP½NÕ Ð2»ÔV zÈ¡qS½@☵DÕ3TmB#M4óM4Ä0Ð)h �S… ¥! ¨ÅH) ©F*A@Š‘j1R/j�™jU¨V¥Z�•je¨V¦ZCD‚¥©E�H)☵( ð)�§@.)@¥"€#"šEHE4Š�ˆÔF¦aQ0 Z¡z™ÅBôÄBæ¡sR¿zèŒÕ59BƀÔÂÔÖjaj�yzizŒµ0µ�M¾õê7PÛèPo¥Ý@ï¥UÃЀ,‡¥U·SƒÐô¡ê°zpj�²¤UCTŠÔ¬¥j•Zª«TÈieMLµTé@-L¢£AS¢Ð…©Ò¢Ô¡hiÁ*P”ð”JP•8JpJ�€%(J°”%�@œ§ N @§©ÂS‚Pp”»*ÀJvÊ�­²•ge!J�ªRšR­¦” 
…*2•l­0¥�S)Q2U¶J‰Ö€*2Ô.µmÖ u 
̵ Z²ëQ2ÐvZŒŠ…FE�DE&*B)¸¤1�§@à(R
h© )â˜*AHT.*v¨\P2¨^§zè¨^§z…é¡5DÕ3TF„f˜iæšiˆm�RÒb€bŠQH)ÀP„(©0T‚˜ ¦-<P¢¤Š•E�H*QQ¨©TP‹S/j‰EL¢€$Z•EF¢¦AHcÔT€R*Ôª´�¡iáh R ¥ÛR„¥Ù@¦•«)…(©Z‰Å[d¨](@Su¨UÇZ®ëLE7ªïVÜUgYê53Ô@1¨ËSÚ¢4�ÒÔÒÔL&€µ©„Ò  7Qº£Í  3Fj=Ô¡¨MÔàÕjPh`ÔðÕ�4ðhµH¦ SR¡  jÊUd«)@¬ ªñŠµÐȵe£jÌi@D©Õ(D©Ñ)0¤ R©PA)BTá)Á(”¡*ÀJP”À€%8%Nœ€ N S„§ 
û)vU€”l 6SJU’”…(±JaJ²V˜R€*¨Ù*ÙZ‰Ö€)ºÔ.µqÖ u 
Žµ­[u¨h£­BËVœT(»
ˆŠ…FE�BE!!ÚCJ)iEBŠx¦Šx¤Å<SH)Õ ÔíP½ zÅXz…Å�WzêÃÔ)¡µDÕ3TF„FšjCL"˜†ÒbŠ� �
P(ž�*@)Ԋ´ÀUZ‘V€µ"­�*­H«@Z•V€V¥U¤T©‘(�U©•hD©‘(�E©ÕhD©Ñ(*eJr%N‰Hw# R„©V:”E@£eZS¼ª�¦R˜R¯˜©�g²T•¢ñÔ/03]*¬‹ZR%U‘(6Dª²-hʕRD EYÅ\‘j³­�Uz…ªw
�„Ó =©†€M!4C@ šLÒQ@Í�Óh�ìӁ¦ŠQ@¤©µ�Jµ:T)S   ÐU¨ÅWŒU¸–€,Dµr%ªñ-]‰hhÖ­F•KW#J�r%XD¡¬¢RŠ• J•R¤ @„§©ÂSÂP)BU€”¡)�JpJœ%(J�„%(Jœ%(Z�ƒm=ª}žÔ 
SJՂ”Ò´T­0­Z+Q2ÐVZ…Ö­:Ô.´QÖ¡u«N*QÅ@â­8ªî(«ŠÅYqP=�WqQ0©œTM@Jy¦Ò”¢ŒP(áOÑO€p©0SÅ C¡j™ª& d*©Þ¡z�ê3Š…页DÕ+TmB#M"¤"šE0c1J; P!ÓÂ҅©Ð!jP´*TʔÀEZ‘Rœ«S*PU*dJr¥N±Ð*eJzGS$t�ÄJ#©R:"ö Ò:"ö©R/j²ûP)µXH½ªt‡Ú§H}©EíRˆ}ªÚCíR¬>ÔLCíNò}ªðƒÚäûP4g}©µjxéQ´>Ô”ñ{Uy"ö­g‡Ú«Éµ y"ªrÇ[2ÅíTe‹­01åJ¥*Vıõª§Z�ʑzÕI´åNµJT EZ®â®Hµ]ր*°¨XaQ0 4ԄS ÑJE  Râ@
)E ð(EJ¢˜¢¤Q@ ©ÐTH*Ìk@ĵr%ªñ­]‰zPñ/J½tªñ'J¿ô  ¢N•v4¨¢J»Rè•a„J°‰@©R©*P”JxJ˜%(J�„%(Jœ-)ÚpJ˜%(Z�‡e*m´m vъ˜­!Z�€­4­NV˜V€+²ÔLµa…Dâ€+8¨U—Š�ªâ z²â«½�UqUÜU—ªÏ@ÜTS¹¨€ jˆÔ­QLa§ša bÐ)8RcSÅ4SÅ *AL  TMS‰¨Ô/S½Bô]ê«*¦„@Õ©š¢4 #"ŠyÜS à´O
«R*Ò*ÔÈ´�¨µ2%µ:%0°"qS¢P‰V(ˆ•2GOD«)±EV*•"ö«1Åí@ˆR/j²ûTÑÃíV£‡Ú$=8«I=*tƒÚ­$Ô] ö«)µYH=ªÊAíL
‰µL°{UćڦX=¨ƒÚ”AíZjw‘í@†jcAíZ¦j‰ ã¥!™µU–jÚx}ª¤°ûP±uâ¨Í^+vXºñYóÅ׊`aÍZϚ>µ·<}k:húÐ4©Ö¨Ê•¯2u¬ùR€3$ZªëZ­T‘(I×-Zu¨h)¤TÅi…h,Rb¤+IŠ�f)@§b”-� à)BӂЪԈ´jdZ�z-Yj4ZµÐÑ-]‰zT/J½
t  /J¿
tªð§JЅ:R`MU蓥Ct«±%�It«(”ˆ•a€S¥Hž«R… ‚S‚Ô¡)BP!)BTÛ)vЀ‡m.*]´m¦[hÅJV“m�DVšV¦+L"€!"˜Â¦"¢a@0¨^¬8¨€ z¬õeê³ÐUž§sUœÐUž§sUœÐP=L櫹 š£j{Tf“i¦”ÒPJ)8Rc)âš)ↅH)‚ž) cT-S5DÔ Ô/SµBâ€+¸¨\U‡
hL…FEL¢"„dQŠq˜¦ @)ê(ž¢QS"ÓTÈ(TZ°‹Q¢Õ˜Ö€‰VQ)‘­[h¸*ÒGIU¸£ 8ªÔq{RÅ\Ž*�lq{U¸áö§Åµ[Š/j28=ªÔp{T±ÃíVã‡Ú˜¤Õe ö©ã‡Ú¬¤>ÔY ö©–j´ûT«µ�TûRù>ÕtEíKå{Py‡Ú£x}«LÅíP¼^Ô”ñ{U9aëÅlɵT–.¼P3XºñYóÅ׊ݚ.<]iƒ<]k6xúÖôñu¬ÉãëL )Ó­g̝knxúÖlÉ׊�ȕ*œ‰Z’§Z§*P#5Ò¡t«Î•]Ҁ*¦«%*2´ZMµ9JMžÔÚPµ.ÏjP”ZpZxZxZ�EZ™…Z€4«q¥F‰V¢J�š$éWá^•^$«ñ/J�±
t­W¥V…:V„IҐĝ*ôKPĝ*ìi@F•e™U„Z€%Hœ«O @†m¥ R¥ @m¥ÛRâ“Àm!Z”­&Ú�Œ­4­JE4Š�ŒŠŒŠ”Š¨&¨Ú¥j…èïP=Lõš�ÍVsS9ªÎh5UÍO!ªÎÔš¬æ¦vªîh5š‘ÍBæ€#cQ{a¤Æ4ÑAæŠ�8SE8RñOÁR
 ¦
R¨Ú¦5
�…D§aQ8 
ì*aÅBš»
ŒŠ™…FE""ŒSˆ¤Å0�)ê)¢¤‘*Â
EN”aZŒUd«qP˜–®FµV!Wb(ÄIWbN•^%«Ñ/J�ž$éWbN• KүĽ(H£éWbŠ›t«±%8ªÜq{QUÈã¦R/j²‘S㎬"PiµH#©•*P”\GKåՐ”¥(‘Ž¢xêùJ…Ò€3dŽªKZՑ*¤©Ö˜óGÖ³§­m̝k>tëH )ãëYsÇÖ·§­fOZ�Áž>µ4}krxúÖlÑõ¦,ÉÖ©JœÖÄÑòjŒ±ó@Œ§JÒ´^:®ñЕJºÑÔf:�¨R•d¥&Ê�¯²€•ce(J�€%<%Lž€"T©Ñ)ËN‰@iÍ[‰)‘¥[(H’¯Ä*“¥]…(ÄIү*¼+Ò¯D)b$éWbZ‚%«q­�L‹SªÓjt�¡iái@§@ŒSÀ£�ÌPVžE&)€Â)¤T„R@‘M4óL4�ÃQ•»Ô-@¹¨Ô®j4 š¬æ¦sU¨jªíS;Ui€!‘ª¬SHÕVF ª³µHíUݨ7j…=Ú¡cI€Ö4ÃJM4Ð0¥ÓsJ()š)␠¦
RñOÁO�ÃLaR‘Q° XTL*r*&]ÅB¬0¨œSBev
…D€""“ò)¤S<Si€%J*ºõ©ÐÐ"Ôuj#TÐÕ¸Í�]‹µ^‹µPˆô«Ðž”~.Õ¡éYðö­yÅ�hB:UøW¥Q‡µhÀ:Pȗ¥_‰:UHGJ¿ô¡,ĵn4¨b^•r5¦"TJš‹Vh� R§§…  ­J­�@R¢e«DTN´NDªr%hºÕI€3fNµŸ:u­iW­P™zÐ3tëY³ÇÖ¶çNµ:u  )ãëYÓGÖ·'­gMZ˜rÇɪRÇ[2ÇÖ©K2$š®ñÖ£ÅíUÞ/j�Íhê#h˜½ª3µ�P1ÒyUtÅíIå{P?*”GVü¯jQµ�UÓÄudEíO{P L‘ÔÂ*•# G[(HêÌqÐâN•r$éL‰*äIғX–¯D•IҮĴÄÑ-[jÖ­"Ð"T2ŠL¢€<
�§
��¥Å¸¦H¤"A i§i ŒÔ†£4T,jF5 š�‰Í@æ¥sUݨªÈÕ4Udj�ŠFª’5M#UY€!vªÒ5HíU¨7j¬íR;TÔ�Çj…=š¢&Ä&›š ¤Í�-8Si“áOÁR
�x§Š`§ŠC)âš) a!¦@0¨˜TÌ)Œ(»
……XaQ0 
ì*&a…DM"¤"˜E0J8¥¤ÀzÔÈjR!  HjÜF©!«1·4ЉºUØ[¥fÄÝ*ôMҀ5an•¡t¬¨[¥hÀÝ(ZÒ´ =+*éZP7J�ԇµhCÚ³`n•£ àPšv«‘Õ(\ŒÓm*Â
¬†¬)  €§ŠMH �:Ñš  ‘Q°© FÔŽ*´‹Vž«¸ 
R­Q™:֌¢©Ê½h.dëYó'Z֕zÕ—­&4ñõ¬ù£ë[2§Z¡*u¦4±õªRE[ÇT䊀2^.zUw‹Úµ^/j®ñsҀ3/jŒÅíZ&/ja‹Ú€3Ì^ԞWµ_1{Ry4GÊö¥{Uß+ڔEí@Ä^Ôáµ[{SÄ^ÔYb©/j°"ö©DT ‰#« =#©Ò:W�*ÔiH‰VcJ�’$«Q­G՘ր&jÂ
‰N‚€dª*aQ-J(ñOÁOÀZ(¢€
CKHh¦˜iƘhQ±§±¨œÐnj»š™ÍVv ݪ«µM#UY€!‘ª¬SHÕRF ¤j©#TÒ5T‘¨7jªíR;Ugj†;TÔçj…š f¨É¥cL&€h¤¢ŽñLñHŠx¦
x¡Œx©0T‚áMñ@
i„T†˜E�FEFÂ¥"˜E�@¢aVTL(»-DËVj&ZÊìµ;-FE�DEâ))€
zžj>ôáL jÄmUÔèÔ~&éWbn•›Uț¥�jÀý+FéY·JсúP#féZp?JŁúVœҀ6an•£ t¬x¥iBý(V&éW¢j˅úU螘Ú¬+Uz²@Õª@ÕX5<=�OºÕhÍ�8šc S P^ ~•#5Bæ€ z©(«nj´”FUªR¯ZДU9Z�͕zÕ)S­iʽjœ©Ö€2厪IjH•UҀ3?j®ñsZn•G@æ*aŠ¯˜é†*� bö£Êö«¦*<ª�¥å{Rˆ½ªàŠ—Ê 
‚/jQµ[S„T ª"ö©:°#§ˆé
ÇS*TŠ•*¥�5¬"P‰S"БjtÄZ™�J‚¦J‰*e *ö©F½ªALCÅ<S( 
ZJ3@¤4¦šM�!5q5�c…ÍHæ s@ vªÎÕ+µVv ¤j«#T²5T‘¨)ªÈÕ,­U%j�†Fª²5K#UWz�‰Ú«»TŽÕYڐÆ;T,Ô÷j„š`&˜MÓs@Íš)ñLñ@ ¦-H) x©0SÅ�<S…4SÅ�8Ši§ši ȦR‘L"€!"£aSQ° YjZ²Â¢+@ÊÔLµa–¢e V!"˜ELE0Š`3
 PÁæ¦CP
‘ �\¹«q7"¨#U¨š˜Q?JЁúVLMÒ¯Âý(béZp?JāúVŒt Fät­(_¥aÁ'JтN”· ô«±=cÃ'J½”­Մz̎J²’qLFŠ½H¨¬•(z�¸þõX=.ú�°Z˜^¢/HZ€ÍP»PZ£/@ sUÜÔ®Õµ�A%UU—5Y謋U$Z¸õYÅ�RtªÎ•yÅ@ë@]*JºéQ 
e)¥*ÙZiJ�©åÑåÕ¢”l 
Â:QXÙNÙ@„t¢:³²€”˜ÈS‚Tá)BPA)áj@”à´�Šµ"­j@´�ª*eÀ*E"Ԃ˜)â˜2AR
ˆSÅ$áLœ �?4f›š3@
M!4„ÓI &£cNcP»P\ÔÔ÷j…Ú€"vª²5M#UWj�ŠFª’5M#UIZ€!•ªœSJÕVF d25Uw©djªíHݪ»µHíP;P41š¢&œÆ£&€i3A4HáLñ@NJTb¥€zԂ˜µ"ÐÅ<SEH(E8R
p B)Ԕ�ÃL"¤4Ò(")„TÄS Tl*r*6-DV¬2ÔL´-FENV£"€""›ŠŠiÄ §Ž´ÚQ@¡©Ñªªš€/ÄõvÅfFÕr'¦´/Ò´`~•‹ô«ðÉҀ6à“¥hÃ/JÆN•~zP#r)zUè¥éX‘KӚ½¾ô±µi%¬ˆå÷«I/½F¢IR‰+5%÷©–Z`h )|ʦ%§ (ÞúMõXIAz�°^˜^¡/M/@/Q;R3ÔE¨ª4æj…Ú€"zêf5š�ÅBâ§z‰¨»-0­L˜E�BV›¶¥"ŒP[hÛíRâŒPa)BÓÂӂÐA)BT¸ -!‘…¥ O K¶€œœ(�€SÀ¤œ(@©4S…0*AQ